ID: 971998297

View in Genome Browser
Species Human (GRCh38)
Location 4:33995284-33995306
Sequence TGGGATTTATTGGGAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971998297_971998306 21 Left 971998297 4:33995284-33995306 CCCTTTTTTCCCAATAAATCCCA No data
Right 971998306 4:33995328-33995350 TCTGCAAGACAAATTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971998297 Original CRISPR TGGGATTTATTGGGAAAAAA GGG (reversed) Intergenic
No off target data available for this crispr