ID: 972006711

View in Genome Browser
Species Human (GRCh38)
Location 4:34118667-34118689
Sequence GACCTCACCATTTTTAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972006711_972006713 5 Left 972006711 4:34118667-34118689 CCAGATCTAAAAATGGTGAGGTC No data
Right 972006713 4:34118695-34118717 CTACAAGCTCTACAAATGATTGG No data
972006711_972006716 18 Left 972006711 4:34118667-34118689 CCAGATCTAAAAATGGTGAGGTC No data
Right 972006716 4:34118708-34118730 AAATGATTGGGGCTTTTTATTGG No data
972006711_972006715 7 Left 972006711 4:34118667-34118689 CCAGATCTAAAAATGGTGAGGTC No data
Right 972006715 4:34118697-34118719 ACAAGCTCTACAAATGATTGGGG No data
972006711_972006714 6 Left 972006711 4:34118667-34118689 CCAGATCTAAAAATGGTGAGGTC No data
Right 972006714 4:34118696-34118718 TACAAGCTCTACAAATGATTGGG No data
972006711_972006717 19 Left 972006711 4:34118667-34118689 CCAGATCTAAAAATGGTGAGGTC No data
Right 972006717 4:34118709-34118731 AATGATTGGGGCTTTTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972006711 Original CRISPR GACCTCACCATTTTTAGATC TGG (reversed) Intergenic
No off target data available for this crispr