ID: 972011180

View in Genome Browser
Species Human (GRCh38)
Location 4:34184118-34184140
Sequence CTCATTCTGATGCTGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972011174_972011180 24 Left 972011174 4:34184071-34184093 CCGAGGCACCAAAAGCTGTGAGT No data
Right 972011180 4:34184118-34184140 CTCATTCTGATGCTGGTGTCAGG No data
972011175_972011180 16 Left 972011175 4:34184079-34184101 CCAAAAGCTGTGAGTACAGCAGA No data
Right 972011180 4:34184118-34184140 CTCATTCTGATGCTGGTGTCAGG No data
972011173_972011180 25 Left 972011173 4:34184070-34184092 CCCGAGGCACCAAAAGCTGTGAG No data
Right 972011180 4:34184118-34184140 CTCATTCTGATGCTGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972011180 Original CRISPR CTCATTCTGATGCTGGTGTC AGG Intergenic
No off target data available for this crispr