ID: 972025686

View in Genome Browser
Species Human (GRCh38)
Location 4:34373857-34373879
Sequence CTGTATCTGCAAAAGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972025686_972025688 21 Left 972025686 4:34373857-34373879 CCATGCTGCTTTTGCAGATACAG No data
Right 972025688 4:34373901-34373923 CAGTTTGTACAATTAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972025686 Original CRISPR CTGTATCTGCAAAAGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr