ID: 972026425

View in Genome Browser
Species Human (GRCh38)
Location 4:34384059-34384081
Sequence CCAATGGGTCCTAGAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972026425_972026436 24 Left 972026425 4:34384059-34384081 CCCATGGCTCTAGGACCCATTGG No data
Right 972026436 4:34384106-34384128 CCAGAAATGATTCTGAATACAGG No data
972026425_972026431 -5 Left 972026425 4:34384059-34384081 CCCATGGCTCTAGGACCCATTGG No data
Right 972026431 4:34384077-34384099 ATTGGAACCAATGGCTCATCTGG No data
972026425_972026437 27 Left 972026425 4:34384059-34384081 CCCATGGCTCTAGGACCCATTGG No data
Right 972026437 4:34384109-34384131 GAAATGATTCTGAATACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972026425 Original CRISPR CCAATGGGTCCTAGAGCCAT GGG (reversed) Intergenic
No off target data available for this crispr