ID: 972027836

View in Genome Browser
Species Human (GRCh38)
Location 4:34409237-34409259
Sequence TCATACTGAATGGGTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972027836_972027843 21 Left 972027836 4:34409237-34409259 CCAGTTTTACCCATTCAGTATGA No data
Right 972027843 4:34409281-34409303 AAATGTCTCTACTTATTTTGAGG No data
972027836_972027841 -10 Left 972027836 4:34409237-34409259 CCAGTTTTACCCATTCAGTATGA No data
Right 972027841 4:34409250-34409272 TTCAGTATGATGTTGGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972027836 Original CRISPR TCATACTGAATGGGTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr