ID: 972030504

View in Genome Browser
Species Human (GRCh38)
Location 4:34451201-34451223
Sequence TAGTATTGATCAGAAGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972030504_972030506 27 Left 972030504 4:34451201-34451223 CCACTGTCTTCTGATCAATACTA No data
Right 972030506 4:34451251-34451273 TGTATAACTGACTGCTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972030504 Original CRISPR TAGTATTGATCAGAAGACAG TGG (reversed) Intergenic