ID: 972030777

View in Genome Browser
Species Human (GRCh38)
Location 4:34455227-34455249
Sequence TTATCAAGCTTGTAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972030774_972030777 6 Left 972030774 4:34455198-34455220 CCAATATACCTGGCCAATGATCT No data
Right 972030777 4:34455227-34455249 TTATCAAGCTTGTAAAAAACAGG No data
972030775_972030777 -2 Left 972030775 4:34455206-34455228 CCTGGCCAATGATCTTCAAATTT No data
Right 972030777 4:34455227-34455249 TTATCAAGCTTGTAAAAAACAGG No data
972030776_972030777 -7 Left 972030776 4:34455211-34455233 CCAATGATCTTCAAATTTATCAA No data
Right 972030777 4:34455227-34455249 TTATCAAGCTTGTAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972030777 Original CRISPR TTATCAAGCTTGTAAAAAAC AGG Intergenic
No off target data available for this crispr