ID: 972041344

View in Genome Browser
Species Human (GRCh38)
Location 4:34604028-34604050
Sequence CTCTAACAGCTGTGGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972041338_972041344 9 Left 972041338 4:34603996-34604018 CCCACTTCAACAGGGATTGTCTG No data
Right 972041344 4:34604028-34604050 CTCTAACAGCTGTGGTTGGATGG No data
972041339_972041344 8 Left 972041339 4:34603997-34604019 CCACTTCAACAGGGATTGTCTGT No data
Right 972041344 4:34604028-34604050 CTCTAACAGCTGTGGTTGGATGG No data
972041337_972041344 13 Left 972041337 4:34603992-34604014 CCTTCCCACTTCAACAGGGATTG No data
Right 972041344 4:34604028-34604050 CTCTAACAGCTGTGGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972041344 Original CRISPR CTCTAACAGCTGTGGTTGGA TGG Intergenic
No off target data available for this crispr