ID: 972044483

View in Genome Browser
Species Human (GRCh38)
Location 4:34647457-34647479
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972044483_972044484 -8 Left 972044483 4:34647457-34647479 CCTACTTCTGACTATTCAGTGGA No data
Right 972044484 4:34647472-34647494 TCAGTGGAATGTCAGATATTTGG No data
972044483_972044485 -5 Left 972044483 4:34647457-34647479 CCTACTTCTGACTATTCAGTGGA No data
Right 972044485 4:34647475-34647497 GTGGAATGTCAGATATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972044483 Original CRISPR TCCACTGAATAGTCAGAAGT AGG (reversed) Intergenic
No off target data available for this crispr