ID: 972044485

View in Genome Browser
Species Human (GRCh38)
Location 4:34647475-34647497
Sequence GTGGAATGTCAGATATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972044483_972044485 -5 Left 972044483 4:34647457-34647479 CCTACTTCTGACTATTCAGTGGA No data
Right 972044485 4:34647475-34647497 GTGGAATGTCAGATATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972044485 Original CRISPR GTGGAATGTCAGATATTTGG TGG Intergenic
No off target data available for this crispr