ID: 972045689

View in Genome Browser
Species Human (GRCh38)
Location 4:34663183-34663205
Sequence GGTCATGGGCCCATGGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972045681_972045689 0 Left 972045681 4:34663160-34663182 CCTGAGTCTGCAGGGTATACCTG No data
Right 972045689 4:34663183-34663205 GGTCATGGGCCCATGGGAATTGG No data
972045680_972045689 7 Left 972045680 4:34663153-34663175 CCTGAAGCCTGAGTCTGCAGGGT No data
Right 972045689 4:34663183-34663205 GGTCATGGGCCCATGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972045689 Original CRISPR GGTCATGGGCCCATGGGAAT TGG Intergenic
No off target data available for this crispr