ID: 972045970

View in Genome Browser
Species Human (GRCh38)
Location 4:34664576-34664598
Sequence TTGTGTCTGAATTTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 1, 2: 5, 3: 33, 4: 514}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972045963_972045970 5 Left 972045963 4:34664548-34664570 CCCCAATCAGACAGTATATCTCT 0: 1
1: 0
2: 2
3: 17
4: 165
Right 972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG 0: 1
1: 1
2: 5
3: 33
4: 514
972045962_972045970 10 Left 972045962 4:34664543-34664565 CCTTTCCCCAATCAGACAGTATA 0: 1
1: 0
2: 1
3: 8
4: 152
Right 972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG 0: 1
1: 1
2: 5
3: 33
4: 514
972045965_972045970 3 Left 972045965 4:34664550-34664572 CCAATCAGACAGTATATCTCTCC 0: 1
1: 0
2: 2
3: 13
4: 146
Right 972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG 0: 1
1: 1
2: 5
3: 33
4: 514
972045961_972045970 15 Left 972045961 4:34664538-34664560 CCTCTCCTTTCCCCAATCAGACA 0: 1
1: 0
2: 5
3: 38
4: 437
Right 972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG 0: 1
1: 1
2: 5
3: 33
4: 514
972045964_972045970 4 Left 972045964 4:34664549-34664571 CCCAATCAGACAGTATATCTCTC 0: 1
1: 0
2: 0
3: 14
4: 190
Right 972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG 0: 1
1: 1
2: 5
3: 33
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972045970 Original CRISPR TTGTGTCTGAATTTGGAGGA GGG Intergenic
900267765 1:1767851-1767873 GTGTGGCTGAATATGGAGGTGGG + Intronic
900971521 1:5994668-5994690 TTGGGTCTGGATTTGGAGCCTGG + Intronic
902104746 1:14025151-14025173 TTGCATCTGAATTTGGAGGCTGG + Intergenic
902445898 1:16464024-16464046 TTCAGTATGAATTTGGAGGTGGG + Intergenic
902981812 1:20128793-20128815 ATGTGACTGTATTTGGAGGTAGG + Intergenic
904227304 1:29033263-29033285 CTGTGTCTGGTTTGGGAGGAAGG - Intronic
905073015 1:35244304-35244326 TTTTGTCTGAAGTTGAAGAATGG + Intergenic
905115529 1:35635984-35636006 ATGTGACTGTATTTGGAGAAGGG + Intronic
905137528 1:35811046-35811068 TGGTGGCTGAAGTGGGAGGATGG + Intronic
905468874 1:38176604-38176626 GTGTGTATGAATTTGGACAAGGG - Intergenic
905766607 1:40606970-40606992 TTGTTTCTGAATTTATAAGATGG + Intergenic
907287222 1:53389677-53389699 CTGTGTCTTCATTTGGTGGAAGG + Intergenic
907696716 1:56738224-56738246 TAGTGTCTTAATTAGGATGAAGG + Intronic
908055105 1:60277538-60277560 ATGTGGCTGTATTTGGAGAAAGG - Intergenic
908435011 1:64097239-64097261 TGCTGACTGAATTTGGAAGAGGG - Intronic
908847527 1:68339908-68339930 TGGTCTCTGAATTCAGAGGAGGG - Intergenic
910508300 1:87975740-87975762 TTATCTCTGAAGATGGAGGAAGG - Intergenic
910720243 1:90278362-90278384 GTGGTTCTGAATTTGTAGGATGG + Intergenic
910750622 1:90626512-90626534 ATGTGACAGAATTTGGGGGAAGG - Intergenic
911172441 1:94783732-94783754 TTGTGTGTGAATTGTGGGGACGG - Intergenic
911275369 1:95853058-95853080 TTGGGTCTGCATTTGGGGCAGGG - Intergenic
911441947 1:97938039-97938061 TTTTGTCTGTCATTGGAGGAAGG + Intergenic
911866943 1:103039404-103039426 TTGTGACTGTATTTGGAGACAGG + Intronic
913050018 1:115109460-115109482 CTGTGTCCAAATGTGGAGGAAGG + Intergenic
913169954 1:116222734-116222756 TGCTGTCTGCATTTGGAGAATGG - Intergenic
914348511 1:146820083-146820105 CTGTCTTTGAATGTGGAGGAAGG - Intergenic
914352193 1:146850072-146850094 CTGTGTCTGAATGTGGGTGAAGG - Intergenic
915765046 1:158354213-158354235 TTGTCTCTGATTTTGGAGAAAGG + Intronic
915903083 1:159860288-159860310 TAGTGTCTGTGTTTGTAGGAAGG - Intronic
916194595 1:162211475-162211497 ATGTGACTGCATTTGGAGAAGGG - Intronic
916555972 1:165894721-165894743 TTGTGTCTGAGTTTTAAGGCAGG - Intronic
918342634 1:183580178-183580200 TTGGGTTTGAAATAGGAGGATGG + Intronic
918691056 1:187479626-187479648 ATGTGGCTTAATTTGGAGAAAGG - Intergenic
919220368 1:194620733-194620755 TGTTGTCTGAGTTTGCAGGAAGG + Intergenic
919267452 1:195288994-195289016 TTATCTCTGAAGATGGAGGAAGG + Intergenic
919591711 1:199511663-199511685 TTGCATCTGAATCTGAAGGAAGG - Intergenic
920096453 1:203489374-203489396 TTCTGTGTGTGTTTGGAGGAGGG - Exonic
920161599 1:204002710-204002732 GTGTGACTGCATTTGGAGTAAGG + Intergenic
921007419 1:211108321-211108343 TTGTTTCTGTTTTTGGAGGGTGG - Intronic
921388288 1:214593124-214593146 TTGTGTCTATATTTGAAGTATGG - Intergenic
921627731 1:217396541-217396563 TTGTGTCTTAATTTGGGGGTGGG - Intergenic
923382378 1:233434439-233434461 AGGTGGCTGAATTTTGAGGAAGG + Intergenic
923678648 1:236101273-236101295 GTGTGTGTGAATGTGGAGGTGGG + Intergenic
924176750 1:241399114-241399136 TTGTTTCTAAATTTGGAGATGGG + Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1063089875 10:2854308-2854330 TTGTGCCTGATATTGGGGGAAGG - Intergenic
1063504556 10:6584011-6584033 TTGAGTCTTGATTTGGAGAAAGG + Intergenic
1064951174 10:20852539-20852561 GTGTACCTGACTTTGGAGGACGG + Exonic
1065308699 10:24393603-24393625 ATGTGGCTGTATTTGGAGGTAGG + Intronic
1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG + Intergenic
1066117077 10:32249983-32250005 GTGTGACTGTATTTGGAGAAAGG - Intergenic
1067841290 10:49681437-49681459 TTGAGTTTGAGTTTGAAGGATGG + Intronic
1068717773 10:60207065-60207087 ATGTGTCTGAATTCTGAGAAGGG - Intronic
1069493047 10:68877923-68877945 TTATGGCTGGATTTGGAGAAAGG + Intronic
1069549631 10:69353959-69353981 TGGTGTCTGAAGTTGGAGGGAGG + Intronic
1069708551 10:70474702-70474724 TTGTGTATGAATTTGGGAGTCGG + Intergenic
1070175450 10:73965805-73965827 TTGTGTCTGAACCAGGAGGGAGG - Intergenic
1070853448 10:79585966-79585988 ATGGGTGTGAGTTTGGAGGAAGG - Intergenic
1070858393 10:79628422-79628444 ATGAGTGTGAGTTTGGAGGAAGG + Intergenic
1071284418 10:84131500-84131522 ATGTGACTGAATTTGGAGATGGG - Intergenic
1072219112 10:93312804-93312826 ATGTGTTTGGAGTTGGAGGAAGG - Intronic
1073541174 10:104317120-104317142 GTGTGTCTGAATATGGGGTAAGG - Intronic
1074752552 10:116600669-116600691 ATGTCTCTGAATTTGGAGTTGGG - Intronic
1074886159 10:117695421-117695443 ATGTGACTGAATTTGGAGATAGG + Intergenic
1075389243 10:122080622-122080644 ATGTGACTGTATTTGGAGGCAGG - Intronic
1075929340 10:126282288-126282310 ATGTGACTGTATTTGGAGAAAGG - Intronic
1076000992 10:126912828-126912850 GTGTGACTGTATTTGGAGGCAGG - Intronic
1076637111 10:131889160-131889182 TTGTATCTGTGTGTGGAGGAAGG + Intergenic
1077922885 11:6655098-6655120 ATGTGTCAGAATGTGGAGGATGG - Intronic
1078229693 11:9428930-9428952 GTGTGTGGGAATTTGGAGGCTGG - Intronic
1078316158 11:10294489-10294511 TTCTGTTTGGATTTGGAAGAAGG + Intergenic
1078865261 11:15291352-15291374 CTGTGAGTGAATTTGGAGGGAGG - Intergenic
1079098550 11:17526747-17526769 TTGTGTCGGAATCTGGGGTAAGG - Exonic
1080103430 11:28486016-28486038 ATGTGTCTATATTTGGAGGCAGG - Intergenic
1080282542 11:30574879-30574901 TTGGAACTGAATTTGCAGGAGGG - Intronic
1080925056 11:36747609-36747631 TTGTGTGTGTGTGTGGAGGAGGG + Intergenic
1084699709 11:70778471-70778493 GTGTGACTGGATTTGGAGAAAGG + Intronic
1085977948 11:81682915-81682937 ATGTGACTGAATTTGGAGTTGGG - Intergenic
1088140308 11:106607942-106607964 GTGTGACTGTATTTGGAGAAAGG + Intergenic
1089960985 11:122617134-122617156 TTCTGTCTGATTCTGGAGGCTGG - Intergenic
1090476075 11:127021649-127021671 GTGTGGCTGGATTTGGAGAAAGG + Intergenic
1091496681 12:979103-979125 ATGTGCCTGTATTTGGAGAAGGG + Intronic
1091757441 12:3063494-3063516 TTGTCTCTGAATTTTCAGGGAGG + Intergenic
1091985593 12:4908676-4908698 TGGCGTCTGAATCTGGAGGAAGG + Intergenic
1092039390 12:5370674-5370696 ATGTGTCTGAGCTTGGTGGAGGG - Intergenic
1092750694 12:11716490-11716512 TTGTGTTAGTATTTGGTGGAAGG + Intronic
1093873643 12:24322925-24322947 TTGTGTTTGAATTGGGAAAAAGG - Intergenic
1095154761 12:38839050-38839072 TTGTGTCAGAGTTAGGAGGCTGG - Intronic
1096120310 12:49084716-49084738 CTGTGTCTGTATTTGGAGAAGGG - Intergenic
1096252753 12:50043806-50043828 ATGTGTGTGAACTTGGAAGAAGG - Intergenic
1096598034 12:52709652-52709674 TTCTTTCTGAATTCGGGGGAGGG - Intergenic
1096947226 12:55420266-55420288 TTCTGCCTGAATTTGCAGAAGGG - Intergenic
1098163727 12:67672384-67672406 ATGTGTCTGTATTTGGAGATAGG + Intergenic
1099834001 12:87883572-87883594 TAGTGTCTCAATTTGGAGATAGG + Intergenic
1100819204 12:98415366-98415388 TGATCTCTGAATTTGAAGGAGGG - Intergenic
1101638351 12:106566327-106566349 GTGTGACTGTATTTGGAGGCAGG + Intronic
1102195699 12:111023774-111023796 TTGTGTTTGGTTTGGGAGGAAGG + Intergenic
1102507924 12:113395569-113395591 TTGTGTCTGTCTTTGAAGGTTGG + Intronic
1102572744 12:113837234-113837256 GTGTGTGTGTATTAGGAGGATGG - Intronic
1103351156 12:120284643-120284665 TTGCCTCTGAATTTGGGAGAAGG + Intergenic
1103454859 12:121057278-121057300 TTGTTTCTGTATTGGGAAGAAGG - Intergenic
1103679884 12:122685012-122685034 ATGTGACTGTATTTGGAGGCAGG - Intergenic
1103814703 12:123644995-123645017 TTGTTTATGGCTTTGGAGGAGGG + Intronic
1104028937 12:125050020-125050042 AAGAGTCTGAATTTGCAGGAGGG - Intergenic
1104505927 12:129332094-129332116 TAGTGTCTGAATCTGGAGACTGG - Intronic
1105991600 13:25627425-25627447 GTGTGGCTGTATTTGGAGTAAGG + Intronic
1106140951 13:27011140-27011162 TTGTAGCTGGATTTGGAGGTGGG + Intergenic
1106497053 13:30287776-30287798 TTGTGTCTGTATTTGTAAGTAGG - Intronic
1107998297 13:45883230-45883252 TTGACTTTGAATTTGGAAGATGG - Intergenic
1109023107 13:57123899-57123921 CTGTGGCTGATTTTGGAAGAAGG + Intergenic
1110232279 13:73179400-73179422 TTTTCTCTGAGTTTGCAGGATGG + Intergenic
1110361320 13:74628960-74628982 TTGTGTTTGACTTTGAAGGGTGG + Intergenic
1110467882 13:75823815-75823837 TAATGTCTGAATCTGGAGAAGGG + Exonic
1111521419 13:89409820-89409842 TTGTGGCAGTATTTGGAGGTGGG + Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112251241 13:97782462-97782484 TTGTGTCTTCATATGGTGGAAGG - Intergenic
1112312825 13:98334660-98334682 ATGTGGCTGTATTTGGAGTAAGG + Intronic
1112325721 13:98441699-98441721 TTGTGGCTGGCTTTGGGGGAAGG + Intronic
1112829203 13:103427996-103428018 ATGTGTCTGTATTTGGAGACAGG + Intergenic
1113545806 13:111148621-111148643 TTCTGTATGAATTGGGAGAATGG - Intronic
1114559447 14:23579523-23579545 TTGCTTCTGAATGGGGAGGAGGG + Intergenic
1115112733 14:29843090-29843112 ATGTGACTGTATTTGGAGGCAGG + Intronic
1115123546 14:29966105-29966127 TTGTGTGAGAATTTGGGGGTTGG + Intronic
1116045660 14:39740050-39740072 TGCTGCCTGAAGTTGGAGGAAGG - Intergenic
1116806523 14:49499310-49499332 ATGTGACTGTATTTGGAGAAAGG - Intergenic
1117877753 14:60273347-60273369 TTGTTTATATATTTGGAGGAAGG + Intronic
1118946760 14:70395794-70395816 TGGTGTCAGAGTTTGGGGGAGGG - Intronic
1120265481 14:82244128-82244150 TGGAGTGTGGATTTGGAGGAAGG - Intergenic
1120468743 14:84895767-84895789 ATGTGACTGTATTTGGAGAAGGG - Intergenic
1120564235 14:86035188-86035210 TTGTGTGTGAATTTGGCAGGTGG + Intergenic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1120952195 14:90051573-90051595 TTGTTTCTGATATTGAAGGAAGG - Intergenic
1121043983 14:90774664-90774686 TTGTTGCTGATGTTGGAGGATGG - Intronic
1124208088 15:27740359-27740381 TTGTGTCTGAATTGGGAGGACGG - Intergenic
1125062144 15:35437436-35437458 TTGGGACTGAGCTTGGAGGAAGG + Intronic
1125120686 15:36155357-36155379 TTGTGACTGTATTTGGAGGTGGG - Intergenic
1126231095 15:46326028-46326050 TTGTATCTTATTTTGGAAGAGGG - Intergenic
1127037438 15:54933455-54933477 TGCTGCCTGAAGTTGGAGGAGGG + Intergenic
1127140324 15:55969482-55969504 TGCTGTCTGAAGTTGGAGGAGGG - Intronic
1128194200 15:65736129-65736151 ATGTGTCTACATTTGGAAGATGG + Intronic
1128727098 15:69996278-69996300 CTGTGTCAGCATTTGGGGGAAGG + Intergenic
1128868309 15:71133145-71133167 TTGAGTCTGAGAGTGGAGGAAGG + Intronic
1129654376 15:77514075-77514097 ATGTGTCTGTATTTGGAGACAGG - Intergenic
1130893472 15:88152346-88152368 TTGTGTCTGTATTTGGAGATGGG + Intronic
1130914966 15:88297907-88297929 GAGTGTATGAATTTTGAGGAGGG + Intergenic
1131440242 15:92454400-92454422 ATGTGACTGTATTTGGAGGGAGG - Intronic
1131540078 15:93268424-93268446 CTGTGGCTGGATGTGGAGGATGG + Intergenic
1131737193 15:95346431-95346453 TTGGCTTTGAACTTGGAGGAAGG + Intergenic
1132693482 16:1192055-1192077 GTGTGTGTGATTTTGGCGGAGGG + Intronic
1132773443 16:1578149-1578171 TTCTGTCTGAATCAGGTGGAGGG - Intronic
1133424349 16:5674857-5674879 TTGTGGCTGAATATGGTGGGTGG + Intergenic
1133904684 16:10011158-10011180 TTGTGCCTGCATTTTGAAGATGG + Intronic
1134268178 16:12709769-12709791 TTGTTCCTGATCTTGGAGGAAGG - Intronic
1134304560 16:13020576-13020598 ATGTGTCTGTATTTGGAGTTGGG - Intronic
1135084945 16:19467803-19467825 ATGTGACTGTATTTGGAGGTAGG - Intronic
1136001231 16:27295380-27295402 GTCTGTCTGGATTTGGAGGGTGG - Intergenic
1137789993 16:51166836-51166858 TTGTGTTTTTATTTGGAAGATGG - Intergenic
1139277082 16:65737944-65737966 TTGTGCCTGAACATGGAGGCTGG - Intergenic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1139981837 16:70865460-70865482 CTGTGTCTGAATGTGGGTGAAGG + Intronic
1140740212 16:77934890-77934912 TGGTGGATGAATTTGCAGGATGG + Intronic
1143959318 17:10701726-10701748 GTGTGTCTGTATTTGATGGAGGG + Intronic
1144075022 17:11709780-11709802 TTGTGTGTGAAGGTGAAGGAAGG - Intronic
1144552181 17:16250438-16250460 ATGTGACTGTATTTGGAGGCAGG - Intronic
1144938997 17:18923947-18923969 TTGTGGGTGATGTTGGAGGAAGG + Exonic
1145942153 17:28748188-28748210 GTCTGGCTGAATGTGGAGGAGGG + Intronic
1146892830 17:36517747-36517769 ATGTGACTGCATTTGGAGAAGGG + Intronic
1148478418 17:47944354-47944376 ATGTGACTGTATTTGGAGAAGGG - Intronic
1148620467 17:49030967-49030989 TTGTGTGTGTATGTGGAGGTGGG + Intronic
1149233783 17:54567508-54567530 TAATGTATGAATTTGGGGGAGGG + Intergenic
1150455323 17:65302729-65302751 GTGTGTCTGTATTTGGAGATGGG - Intergenic
1150974596 17:70070508-70070530 TTATGTTTGTATTTGGAGGAGGG - Intronic
1151143231 17:72015420-72015442 TTCTGTCTGCATTTGAAAGAGGG - Intergenic
1151410526 17:73924436-73924458 ATGTGACTGAATTTGGAGATAGG + Intergenic
1151716552 17:75834133-75834155 TTGTGTCTCCAGTTGGAGGTGGG - Exonic
1151725571 17:75881861-75881883 GTGTGTCTGATTTGGCAGGAGGG + Intronic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1153022639 18:644982-645004 TTGAGTGTGAAATTAGAGGAAGG - Exonic
1153284983 18:3449206-3449228 TTCTGTTTGAAATGGGAGGAGGG + Intronic
1153390279 18:4549816-4549838 ATCTGTCTGAATTTAGAGTATGG - Intergenic
1153583046 18:6594659-6594681 TTGTGTCTTTGTTTGGCGGAGGG + Intergenic
1153623976 18:7005820-7005842 TGGTGTCTGGGCTTGGAGGATGG - Intronic
1153745308 18:8172642-8172664 TTGTGTCCTAATTGTGAGGAAGG + Intronic
1155233412 18:23795880-23795902 GTGTGACTGTATTTGGAGTAAGG + Intronic
1155444988 18:25901620-25901642 GTGTAGCTGTATTTGGAGGAAGG + Intergenic
1155595837 18:27485597-27485619 CTGTGTCTGTATTTGAAGCATGG - Intergenic
1155626248 18:27838267-27838289 TTTTGTTTGAATTTAGAGGAGGG + Intergenic
1155835947 18:30584197-30584219 ATATATCTGAATCTGGAGGAAGG - Intergenic
1157048009 18:44125798-44125820 TTGTGGTTGAATTTAGGGGAGGG - Intergenic
1157305295 18:46512450-46512472 TTGTCTCTGAATTTTCAGGGAGG + Intronic
1157822567 18:50784453-50784475 GTGTGTGTGTGTTTGGAGGAGGG - Intergenic
1158028616 18:52934668-52934690 ATGTGACTGTATTTGGAGAAAGG + Intronic
1158328884 18:56339691-56339713 CTCTGTCTGAATATGGAGCAGGG - Intergenic
1159195252 18:65105170-65105192 CTTTATCAGAATTTGGAGGAAGG - Intergenic
1159366738 18:67475860-67475882 TTGTGTCACAGTTTTGAGGAGGG - Intergenic
1159901105 18:74046569-74046591 ATGTGGCTGTATTTGGAGTAAGG + Intergenic
1159964735 18:74584049-74584071 GTGTGTCTGTATTTGGAGACAGG - Intronic
1159984840 18:74829922-74829944 TTGTGACTGTATTTGGAGATAGG + Intronic
1160033646 18:75282501-75282523 TTGTGGCTGTATTTGGAGAAGGG + Intronic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160301969 18:77690193-77690215 TGGTGTCTGAATAAGGAGAACGG - Intergenic
1162114964 19:8423504-8423526 TTGTGTGTGTACTTGGGGGAGGG + Intronic
1162150776 19:8644067-8644089 GTGTGACTGAATTTGGAGATAGG + Intergenic
1162307118 19:9881889-9881911 ATGTGACTGTATTTGGAGGTGGG - Intronic
1162695424 19:12470052-12470074 TTCTTTCTGAAATTGGAGAAAGG - Intronic
1163501951 19:17681395-17681417 TTGTGTGTGATGTTGGTGGAGGG + Intronic
1164588200 19:29490806-29490828 TTGTGTGTGCATGTTGAGGATGG - Intergenic
1167559059 19:50214622-50214644 CTGTGTGTGAATTTGAATGAAGG - Intronic
1167818141 19:51902343-51902365 TTGCGTCTGAAGTTGGGGGCAGG - Intronic
1168209549 19:54880586-54880608 TTGTGTGGTAATTTGGAGGAAGG + Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168474772 19:56667827-56667849 TTGTGTCTTCATTTGGAGGAAGG - Intronic
925302153 2:2824925-2824947 GTGTGACTGTATTTGAAGGAAGG - Intergenic
925645008 2:6026895-6026917 TTGTGTCTGACTTTGGAGATAGG + Intergenic
925822897 2:7817983-7818005 ATGTGACTGTATTTGGAGGTAGG - Intergenic
926052821 2:9755641-9755663 ATGTGACTGCATTTGGAGAAAGG + Intergenic
926109718 2:10174019-10174041 GTGTGGCTGCATTTGGAGTAGGG + Intronic
926310942 2:11675851-11675873 GTGTGACTGTATTTGGAGTAAGG + Intergenic
926544776 2:14226072-14226094 TTGGCTTTGAATATGGAGGAAGG - Intergenic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
928719315 2:34100939-34100961 GTGTCTCTGAGCTTGGAGGAGGG - Intergenic
930140040 2:47942376-47942398 TTGTGGTTGTATTTGGAGGTGGG - Intergenic
931020276 2:58037038-58037060 ATGAGTCTGAAATGGGAGGATGG - Intronic
933327128 2:80852354-80852376 GTGTCTCTGATCTTGGAGGAGGG + Intergenic
935290869 2:101610034-101610056 ATGTGACTGCATTTGGAGGTAGG + Intergenic
935404148 2:102690494-102690516 TTGTTTCTGATTTTCGAAGATGG + Intronic
935563198 2:104579185-104579207 TTGTGACTGTATTTGGAGACAGG - Intergenic
936632103 2:114214729-114214751 TTGTGTCTGTGTTTTGAAGAAGG + Intergenic
937122123 2:119447965-119447987 ATGTGACTGCATTTGGAGAAAGG + Intronic
938276456 2:130029521-130029543 TTGTGTATGTATTGGGAGGGGGG - Intergenic
938327413 2:130420279-130420301 TTGTGTATGTATTGGGAGGGGGG - Intergenic
938337731 2:130513955-130513977 TGGTGACTGAATTAGGAGGGTGG + Intergenic
938352108 2:130606780-130606802 TGGTGACTGAATTAGGAGGGTGG - Intergenic
938362528 2:130701198-130701220 TTGTGTATGTATTGGGAGGGGGG + Intergenic
938438916 2:131307838-131307860 TTGTGTATGTATTGGGAGGGGGG + Intronic
938541621 2:132288015-132288037 TTGGGTCTGAATTTCTGGGAGGG + Intergenic
938943245 2:136187775-136187797 TGGTGTGTGAATTTAGAGGCTGG + Intergenic
939600381 2:144181948-144181970 CAGAGTCTGAATTTGAAGGAGGG - Intronic
939804901 2:146763389-146763411 TTTTGTTTCATTTTGGAGGAGGG - Intergenic
941907910 2:170734821-170734843 TTGTGCCTGAATTTCAAGGGAGG - Intergenic
942136555 2:172931618-172931640 TTGTGGTTAACTTTGGAGGAAGG - Intronic
942224066 2:173799167-173799189 ATCTATCTGAATTTGGAGAAAGG - Intergenic
942737353 2:179129985-179130007 TTGTTTCAGAATTGGGAGGTAGG - Intronic
942752390 2:179302688-179302710 ATGTGACTGTATTTGGAGAATGG + Intergenic
942992895 2:182223026-182223048 GTGTGTCTGTATTTGGAGACAGG + Intronic
943218708 2:185075840-185075862 TTGTTTCTGCTTTTGGGGGATGG - Intergenic
944297239 2:198080203-198080225 TTGTGTATGTATTGGGAAGATGG - Intronic
945203189 2:207305512-207305534 TTGTGTCCTAAGTTGGAGGCTGG + Intergenic
945350127 2:208767547-208767569 TTGTGTCTGAAAATGGAAGGAGG - Intronic
947424953 2:229974938-229974960 TTATGTCTGCATTTCGATGAAGG - Intronic
948524818 2:238564962-238564984 GTGTGACTGTATTTGGAGGCAGG + Intergenic
1169275445 20:4230745-4230767 ACGTGGCTGAATTTGGAGGAAGG - Intronic
1169985182 20:11435910-11435932 TGGGGTCTGGGTTTGGAGGACGG + Intergenic
1170008504 20:11694882-11694904 TGGTGCATGGATTTGGAGGAGGG + Intergenic
1170235925 20:14105323-14105345 GAGAATCTGAATTTGGAGGAAGG + Intronic
1170425696 20:16233331-16233353 CTGTGGCTAAATTTGGAGGGAGG - Intergenic
1170425843 20:16234889-16234911 TTGTGGCTAAAATTGGAGAAGGG - Intergenic
1170446550 20:16433954-16433976 CTGTGTCTGGAGTTGGGGGAGGG - Intronic
1171015167 20:21534175-21534197 CTGTGTCATAATATGGAGGAAGG - Intergenic
1171870487 20:30520891-30520913 TTGGGTCTGAATTTCTGGGAGGG + Intergenic
1172469021 20:35177117-35177139 TTCTGTCTGTCTTTGGAGGATGG - Exonic
1172795547 20:37534783-37534805 TTGTGACTTATTTTGGAGGCAGG - Intergenic
1172863602 20:38077437-38077459 TAGTGTCTGATTTTGATGGATGG - Intronic
1172899709 20:38325598-38325620 GTGTGGCTGCATTTGGAGAAGGG - Intronic
1172950801 20:38722543-38722565 GAGTGTCTGTATTTGGAGGACGG + Intergenic
1173254532 20:41384787-41384809 ATGTGACTGTATTTGGAGGTTGG - Intergenic
1174068434 20:47882949-47882971 TTGTTGGTGCATTTGGAGGATGG + Intergenic
1174151067 20:48486690-48486712 ATGTGCTTGAATATGGAGGAAGG + Intergenic
1174705403 20:52650318-52650340 TAGTGTCTGAATCTGCAGGTAGG - Intergenic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1175310380 20:58007618-58007640 ATGTGACTGTATTTGGAGGTAGG + Intergenic
1175539416 20:59738973-59738995 TGGTGTCTGTAGGTGGAGGAAGG + Intronic
1177054657 21:16286133-16286155 TTGTGTTTTATTTTGGGGGAAGG + Intergenic
1177615374 21:23510466-23510488 TTGTCTCTGAAGTTGTAAGAGGG - Intergenic
1178368767 21:32009806-32009828 ATGTGTCTGCATTTGGAGCTAGG + Intronic
1178510366 21:33200297-33200319 ATGTGGCTGCATTTGGAGAAAGG - Intergenic
1178666350 21:34550385-34550407 ATGTGACTGTATTTGGAGGTAGG + Intronic
1178765161 21:35443665-35443687 CTCTGTCTGAATTTGGAGAAGGG - Intronic
1179024531 21:37668535-37668557 ATGTGGCTGTATTTGGAGGTAGG - Intronic
1179174205 21:38995683-38995705 ATGTGACTGAATTTGGAGATAGG - Intergenic
1179241383 21:39596138-39596160 ATGTGACTGTATTTGGAGGTAGG + Intronic
1179443124 21:41409895-41409917 ATGTGACTGCATTTGGAGGTAGG - Intergenic
1179802069 21:43815850-43815872 CTGTGACTGTATTTGGAGGTAGG - Intergenic
1180641410 22:17302384-17302406 ATGTGACTGCATTTGGAGAAGGG + Intergenic
1181540726 22:23571793-23571815 ATGTGTCTGTATTTGGAGATAGG + Intergenic
1182684534 22:32111421-32111443 GTGTGACTGTATTTGGAGGTAGG - Exonic
1183006306 22:34905521-34905543 TGGTGTCTGAAGCAGGAGGAGGG + Intergenic
1184592299 22:45493196-45493218 ATGTGCCTGTATTTGGAGGTAGG - Intergenic
1184622621 22:45693683-45693705 ATGTGACTGAATTTGGAGATAGG + Intronic
1184858451 22:47159835-47159857 TTGTGTCTGTATGTGGAGTGTGG - Intronic
1184995727 22:48206022-48206044 TTGTCTCTGGATTGGGAAGAGGG + Intergenic
1185198198 22:49485807-49485829 GTGTGGCTGTATTTGGAGGCAGG + Intronic
950623416 3:14226110-14226132 ATGTTTCTGCAATTGGAGGAGGG - Intergenic
950817881 3:15726115-15726137 TTGTGTCTGAGTGAAGAGGAAGG - Intronic
950869378 3:16215576-16215598 TTCTGTCTGAATTTGGGGGAAGG + Intronic
951138976 3:19139154-19139176 TTGAGTATAAATTTTGAGGATGG + Intergenic
951524866 3:23644082-23644104 ATGTGACTGTATTTGGAGGTAGG + Intergenic
952207923 3:31198952-31198974 TTTTGTCTGAGTCTTGAGGAGGG - Intergenic
952402543 3:32976401-32976423 TTGTGTCTGCATGTGGACCAAGG - Intergenic
952527256 3:34223700-34223722 TTTCGTCTGACTTTGGAAGAGGG - Intergenic
952743790 3:36759752-36759774 CTGTGTCTGGGATTGGAGGAGGG - Intergenic
953341559 3:42138913-42138935 GTGTGTGTGTGTTTGGAGGAGGG + Intronic
953594470 3:44296817-44296839 CTGTGTCTGGTTTTGGAGGCTGG - Intronic
953778514 3:45844001-45844023 GTGTGTGTAAATTTGGAGGGAGG + Intronic
954764747 3:52904428-52904450 TTATGACAGAATTTGGAGGGGGG - Exonic
954812154 3:53255187-53255209 TTGGGTCCGAGTTTGGAGCAGGG - Intronic
954844853 3:53546359-53546381 GTGGGTCTGAATTTGGGGTAGGG + Intronic
955877197 3:63504466-63504488 TGGTTTGTAAATTTGGAGGAGGG - Intronic
956595089 3:70958689-70958711 TTGTGTGTGTATTGGGGGGAGGG - Intronic
956793904 3:72701202-72701224 ATGTGACTGTATTTGGAGAAAGG + Intergenic
956881560 3:73516108-73516130 TTGTTTCTAATTTGGGAGGAAGG + Intronic
956927537 3:74005314-74005336 ATGTGACTGTATTTGGAGGCAGG + Intergenic
956930317 3:74035933-74035955 ATGTGTCTGTATTTGGAGACAGG - Intergenic
957183545 3:76912813-76912835 TTTTGTCTGAATTTGGAGAAGGG + Intronic
957362380 3:79175975-79175997 TTGAGTATGAAAGTGGAGGAAGG - Intronic
957444469 3:80297038-80297060 ATGTGTCTAAATTTGGGGAACGG - Intergenic
957447604 3:80335081-80335103 TTGTGTCTGATTTTGGTGCCAGG + Intergenic
957744325 3:84318767-84318789 TATTGTCTGTACTTGGAGGAGGG + Intergenic
957796052 3:85009217-85009239 ATGTCTCTGAATTTGCAGGGAGG - Intronic
958096700 3:88954960-88954982 TTATGTCTGTATTTTGAGAAAGG - Intergenic
958954624 3:100453762-100453784 TTGTGCCTGTGTTTGGAGGTGGG - Intronic
959472335 3:106767310-106767332 CTGGCTTTGAATTTGGAGGAAGG + Intergenic
959608102 3:108264001-108264023 GTGTGACTGTATTTGGAGAAAGG - Intergenic
959784198 3:110273915-110273937 TTGTGACTGCATTTGGAGGAAGG - Intergenic
960678140 3:120217535-120217557 GTGTGTCTGTATTTGGAGATAGG - Intronic
961096104 3:124158190-124158212 TTGTGGCTGAATGAGGAGGGTGG + Intronic
961990276 3:131182453-131182475 TTGTCTCTGATCTTGCAGGATGG + Intronic
962203829 3:133419231-133419253 ATGTGACTGTATTTGGAGAAAGG - Intronic
962441889 3:135427642-135427664 ATGTGTCTGTATTTGAAGGTGGG + Intergenic
962625638 3:137223225-137223247 TTGTGTACTAATTTGGAAGATGG + Intergenic
962638706 3:137360874-137360896 AGCTGTCTGGATTTGGAGGAGGG + Intergenic
962682055 3:137810521-137810543 GTGTGACTGTATTTGGAGAAAGG + Intergenic
962941654 3:140130114-140130136 TGGTTTCTAAACTTGGAGGAGGG + Intronic
962942655 3:140139939-140139961 TTGTCTCTGAATTTGGAAAGAGG + Intronic
964668442 3:159199335-159199357 TTGTCTTTAAAGTTGGAGGAAGG + Intronic
964682375 3:159356425-159356447 TTTTGTTTTATTTTGGAGGATGG + Intronic
965537289 3:169836617-169836639 GTGTGAATGAATTTGGAGAAGGG - Intronic
967325533 3:188234932-188234954 TTTTGTCTGGAGTTGGAAGAAGG - Intronic
967360642 3:188626742-188626764 TTGTGACTGTATTTGGAGAAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967949620 3:194830692-194830714 TTGTGTCTGAATGTGGCTGTGGG + Intergenic
969925595 4:10583069-10583091 TTGTTTCTGATTTTTGACGATGG - Intronic
970049697 4:11899509-11899531 TTGTGACAGTATTTGGAGAAAGG + Intergenic
970187171 4:13469505-13469527 TTGGAACTGAAGTTGGAGGAAGG - Intronic
971788860 4:31141534-31141556 ATGTGTCTGTCTTTGGAGAATGG - Intronic
971810939 4:31425960-31425982 TTGTGTGTGCATATGTAGGATGG + Intergenic
972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG + Intergenic
972638745 4:40907230-40907252 ATGTGACTGTATTTGGAGAAAGG + Intronic
972648362 4:40991687-40991709 GTGTGTCTGTTTTAGGAGGAGGG - Intronic
972675150 4:41253038-41253060 TTGTGTGTGTGTTTGGGGGATGG - Intergenic
972749551 4:41974377-41974399 GTATGTCTGTATTTGGAGAAAGG - Intergenic
973139668 4:46750927-46750949 GTGTGTCTGTATTTGGAGATAGG - Intronic
973625202 4:52765034-52765056 GTGTGACTGTATTTGGAGGTAGG + Intergenic
973804247 4:54510151-54510173 TTCAGTCTGAGTTTGAAGGAAGG + Intergenic
974822101 4:67080472-67080494 TTGTGACTGCATTTGGAGATGGG - Intergenic
976390649 4:84500874-84500896 TTGAGTCTGAAACTGGGGGAAGG + Intergenic
977174022 4:93797637-93797659 TTGACTCTGAGCTTGGAGGAGGG - Intergenic
977777400 4:100937335-100937357 TTGTTTCTGAATTTTGGGGAAGG + Intergenic
977982081 4:103336280-103336302 ATGTGACTGTATTTGGAGAAGGG - Intergenic
978335574 4:107664942-107664964 TTGGGTGTGAATTTTGAAGAGGG - Intronic
978625012 4:110675456-110675478 TAGTATATGTATTTGGAGGAAGG + Intergenic
980098122 4:128514191-128514213 ATGTGACTGTATTTGGAGGCAGG + Intergenic
980905659 4:138946360-138946382 GTGTGTCTGTATTTGGAGATGGG + Intergenic
981028754 4:140102617-140102639 ATGTGACTGTATTTGGAGGGCGG - Intronic
981305884 4:143246786-143246808 ATGTGACTATATTTGGAGGAGGG - Intergenic
981788271 4:148505222-148505244 TTGTGACTGTATTTGGAGACAGG + Intergenic
982043572 4:151419303-151419325 TTGAGTCTGAATCTGAAGGCAGG - Intronic
982069324 4:151681824-151681846 CTGTGTCTGCATGTGGTGGAAGG + Intronic
984137937 4:175964688-175964710 ATGTGTCTGTATTTGGAGAGAGG - Intronic
984337478 4:178411175-178411197 TTGTGTCTGCACATGGAAGAAGG - Intergenic
984777536 4:183495244-183495266 TAGTGTCTGTATTTAGAGGATGG - Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985932795 5:3072259-3072281 GTGTTTCTGTATTTGGAGTAAGG + Intergenic
987064318 5:14273460-14273482 TTGTGTTTGAAGTCAGAGGACGG + Intronic
987213571 5:15709571-15709593 TTCTGTCTGTATTTGAAGGTGGG - Intronic
987263759 5:16229755-16229777 ATGTGACTGAATTTGGAGATAGG + Intergenic
988329035 5:29811001-29811023 ATGTGTCTGTATTTGGAGACAGG + Intergenic
989002027 5:36771115-36771137 TTGTGACTGTATTTGGAGACAGG - Intergenic
989712135 5:44411816-44411838 TTGTGTCTGAATTTGTTTCAGGG + Intergenic
990007372 5:50959671-50959693 ATGTGTCTTAATTTGTTGGAGGG + Intergenic
990687694 5:58325268-58325290 TTTTGTCTGAATCTGAACGAGGG - Intergenic
991058276 5:62343194-62343216 TTGTCTCTGAAATTGAAGTAAGG + Intronic
991538309 5:67697737-67697759 TCCTCTCTGAATTTGGAGAAGGG - Intergenic
992839690 5:80675898-80675920 TTATATCTAGATTTGGAGGAGGG + Intronic
993708378 5:91196938-91196960 CTGTGACTGAATTTGGAGATAGG + Intergenic
994282372 5:97921122-97921144 TTGTGATGGAATTTGGAGGCAGG + Intergenic
994311644 5:98278958-98278980 ATGTGTCTGTATTTGGAGAGAGG - Intergenic
994376711 5:99023114-99023136 TTGTGTGTGTGTGTGGAGGAAGG + Intergenic
994652785 5:102550092-102550114 ATGTGACTGAATTTGGCTGATGG + Intergenic
994847768 5:105011973-105011995 TTGTGTCTGTATTGGTGGGAGGG - Intergenic
995819976 5:116218933-116218955 ATGTGTCTGTATTTGGAGATAGG + Intronic
996219304 5:120910116-120910138 ATGTGACTGTATTTGGAGAAAGG - Intergenic
997392686 5:133530052-133530074 TTTTAGCTGAATTTGGAGGCAGG - Intronic
997900992 5:137764176-137764198 TTGTGACAGTATTTGGAGGTGGG + Intergenic
1000562048 5:162801417-162801439 TTGAGTCACTATTTGGAGGAGGG + Intergenic
1000743318 5:164997641-164997663 TTGAATTTGAATTTGGATGATGG + Intergenic
1001056216 5:168452330-168452352 ATGTGACTGTATTTGGAGGTAGG + Intronic
1001805432 5:174581622-174581644 CTTTGTCTGATTTTGAAGGACGG - Intergenic
1002486170 5:179538662-179538684 TTGTGTGTAAATGTGAAGGAAGG + Intergenic
1003480067 6:6523152-6523174 TTGTTTCTGAACTTGGAGACAGG - Intergenic
1003674238 6:8188428-8188450 TTGTGTAGGAATTTGGTGTATGG + Intergenic
1003741748 6:8948289-8948311 TTGTGACTGTATTTGGAGACAGG - Intergenic
1004158289 6:13190414-13190436 ATGTGACTGTATTTGGAGTAAGG - Intronic
1004369637 6:15040846-15040868 TTGTGGCTGAATTTGGATGAAGG + Intergenic
1004849446 6:19683140-19683162 TTGTGTCTGAATTTGTGGAGGGG - Intergenic
1005155513 6:22801694-22801716 TTGTGTGTGTATTTGGGGGTTGG - Intergenic
1005352783 6:24953007-24953029 GTGTGGCTGTATTTGGAGTAAGG + Intronic
1005814548 6:29540145-29540167 ATGTGACTGAATTTGGAGACAGG + Intergenic
1006909091 6:37552428-37552450 TTGTTTATGAATTTTGAGGCTGG + Intergenic
1007756071 6:44100678-44100700 TCGTGTCTGACCTTGGTGGAGGG - Intergenic
1007933436 6:45712737-45712759 TTGTGTCTGAATTTGAGTAATGG + Intergenic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008008067 6:46433587-46433609 TTGGCTTTGAAGTTGGAGGAAGG + Intronic
1008331760 6:50253948-50253970 GTGTGACTGTATTTGGAGAAAGG + Intergenic
1008645118 6:53505832-53505854 CAATGTCTGAGTTTGGAGGAGGG + Exonic
1008662359 6:53681433-53681455 TAGTGTCTGAACTCTGAGGATGG + Intergenic
1008946317 6:57100958-57100980 TTGTGTCTGGAGATAGAGGATGG - Intronic
1010517672 6:76792483-76792505 TGGTTTCTGAAATGGGAGGATGG + Intergenic
1010674648 6:78727801-78727823 ATGTGACTGTATTTGGAGAAAGG + Intergenic
1010721950 6:79292637-79292659 TTGTGTCTCATTTTAGAAGATGG + Intergenic
1011176640 6:84568811-84568833 ATGTCTCTGAGTTTGAAGGAAGG + Intergenic
1011859277 6:91734983-91735005 TTGTGTCTGCAGTTTGAGAATGG - Intergenic
1011884159 6:92072694-92072716 TTGTGTTTTATTTTGAAGGAAGG - Intergenic
1011911247 6:92442327-92442349 TTGTGTTTGAATATGAATGACGG + Intergenic
1012160972 6:95885794-95885816 ATGTGGCTGTATTTGGAGTAAGG - Intergenic
1013006760 6:106081176-106081198 TCGTGTCTGAGTTTGGAAGAAGG - Intergenic
1013062644 6:106651689-106651711 CTGTATCTGAATTTCTAGGAGGG + Intronic
1014471810 6:121824831-121824853 TTGTGTCAGACATTGGAGAATGG + Intergenic
1014961694 6:127694749-127694771 ATGTGACTGTATTTGGAGAAAGG - Intergenic
1015469275 6:133585392-133585414 GTGTGACTGTATTTGGAGGTAGG + Intergenic
1016015669 6:139183065-139183087 ACGTGTCAGAATTTGGAGCAAGG + Intergenic
1016565779 6:145452142-145452164 TGATGTCTGGATTTGGAGAATGG - Intergenic
1019000642 6:168747239-168747261 TAGTGGTTGACTTTGGAGGATGG - Intergenic
1019468932 7:1207537-1207559 TTGTGTCTGGTTCAGGAGGAGGG - Intergenic
1019951121 7:4373570-4373592 TTGTGACTGTATTTGGAGACAGG - Intergenic
1022045779 7:26621135-26621157 TTGTGTCTGGCTTTGGAGTTAGG - Intergenic
1022120269 7:27301596-27301618 GTGTGACTGTATTTGGAGAAAGG + Intergenic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1024126539 7:46303310-46303332 TCTTGCCTGAATTTGGAGAAAGG + Intergenic
1024886405 7:54147497-54147519 ATGTGACTGCATTTGGAGAAAGG - Intergenic
1025069184 7:55884147-55884169 ATCTGTCTGTATTTGGGGGATGG - Intergenic
1026442878 7:70459282-70459304 TTGTGCCTCAATTTCAAGGATGG - Intronic
1027400239 7:77799024-77799046 TTCTGACAGAATTTCGAGGATGG + Intronic
1027564786 7:79777983-79778005 TTGTGTTAGAATTGGGATGAAGG - Intergenic
1027769116 7:82384248-82384270 GTGTGTCCGTATTTGGAGAAGGG + Intronic
1028869728 7:95756169-95756191 CTGTTTCTGATTTTGGAGGACGG - Intergenic
1030080766 7:105775810-105775832 ATGTGGCTGAATTTGGATGAGGG + Intronic
1030212490 7:107010285-107010307 TTGTGTTTGCATTTGGAAAAGGG - Intergenic
1030496748 7:110310329-110310351 TTTTGACAAAATTTGGAGGATGG + Intergenic
1030985555 7:116237962-116237984 ATGTGACTGTATTTGGAGCAGGG - Intronic
1031042336 7:116851351-116851373 GTGAGTCTGAAGTGGGAGGATGG + Intronic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1032019316 7:128398254-128398276 TGGTGTCAGAATTAGGAGGGTGG - Intronic
1033436795 7:141340126-141340148 TTGGCTTTGAATATGGAGGAAGG + Intronic
1035857389 8:2990647-2990669 TTGTGTCTTATTTAGGAGGGAGG - Intronic
1036234005 8:7022552-7022574 TTGTGTCTTCATCTGGTGGAAGG - Intergenic
1037197830 8:16213510-16213532 TTGAGTCCGTATCTGGAGGAAGG - Intronic
1037324782 8:17677822-17677844 TGGTCTATGCATTTGGAGGAGGG - Intronic
1037457569 8:19079107-19079129 CTGTGTGTGAATGTTGAGGATGG + Intronic
1037611769 8:20481851-20481873 TTGTGACTGTATTTGGAGATAGG + Intergenic
1038485617 8:27933021-27933043 ATGTGACTGTATTTGGAGGCAGG - Intronic
1038558719 8:28549259-28549281 ATGTGACTGTATTTGGAGGTGGG - Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1040365434 8:46710305-46710327 TTGTGAATGCCTTTGGAGGAAGG + Intergenic
1041222130 8:55662517-55662539 TTGTGCCTGAGGTTGGAGGAAGG - Intergenic
1041693210 8:60710411-60710433 TTGTCTCTGACTGTGGAAGATGG + Intronic
1042261187 8:66861016-66861038 TGGAGGCTGAAGTTGGAGGATGG + Exonic
1043771394 8:84206090-84206112 ATATGTCTGCATTTGGAGAAAGG - Intronic
1043861107 8:85318133-85318155 TTGTGTCTGAATTTTTAGCATGG + Intergenic
1044240468 8:89882464-89882486 ATGTGTTTGTATTGGGAGGAAGG - Intergenic
1044283886 8:90388868-90388890 TCATGTGTGAATTTGCAGGATGG - Intergenic
1044587941 8:93885320-93885342 TAGAGTCAGATTTTGGAGGAAGG + Intronic
1044776829 8:95698751-95698773 TTGTGTGTGTGTTTGGGGGAGGG - Intergenic
1045927886 8:107592019-107592041 TTGTTTCTAAATTTCGAGGGAGG + Intergenic
1045979145 8:108163526-108163548 TTATCTCTGGATTTTGAGGAAGG + Intergenic
1046010097 8:108535911-108535933 ATTTGTCTAAATTTTGAGGAGGG + Intergenic
1046120682 8:109842560-109842582 GTGTGACTGAATTTGGAGATTGG + Intergenic
1046526941 8:115392742-115392764 CTGTGTCTCATTTTGGAAGATGG + Intergenic
1046691038 8:117284409-117284431 GTGTGGCTGGATTTGGAGTAGGG + Intergenic
1048043886 8:130755388-130755410 TAGTGTCTGAATTTTCAGGGAGG + Intergenic
1048129487 8:131678627-131678649 TTGTGTTTGAATTGGAAAGAAGG - Intergenic
1048147227 8:131857175-131857197 ATATGTGTGACTTTGGAGGATGG - Intergenic
1048473405 8:134722833-134722855 ATGTGACTGCATTTGGAGAAAGG + Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1048714775 8:137256228-137256250 ATGTGACTGTATTTGGAGAAAGG - Intergenic
1050164930 9:2755590-2755612 TTGTGGCTATATTTGGAGTATGG - Intronic
1050176870 9:2877326-2877348 TTGTGTCAGAAGGTGGAGGGTGG + Intergenic
1050190372 9:3019014-3019036 GTGTGGCTGTATTTGGAGTAAGG - Intergenic
1051020585 9:12537828-12537850 TTCTGTCTGAATTTGCTGGAAGG + Intergenic
1051135541 9:13916151-13916173 ATGTGGCTCAATTTGAAGGAGGG + Intergenic
1051198613 9:14591644-14591666 TTATGTCTCAATTTGTATGAAGG - Intergenic
1051493710 9:17695814-17695836 ATGTCTCTGAAATTGGAGGATGG + Intronic
1052295841 9:26895269-26895291 ATGTGACTGAATTTGGAGATAGG + Intergenic
1052649532 9:31283583-31283605 ATGTGACTGTATTTGGAGAAAGG + Intergenic
1052944681 9:34158690-34158712 ATGTGACTGTATTTGGAGAAAGG + Intergenic
1052958237 9:34271835-34271857 TTTGATCTGAATTTGGATGACGG + Exonic
1053103091 9:35387989-35388011 TTCAATCTGAATTTTGAGGAAGG + Intronic
1054729739 9:68689153-68689175 TTGTGTGTGATTGTGGAGGCTGG + Intergenic
1056255781 9:84798167-84798189 TTGTGTCTTCATCTGGTGGAAGG + Intronic
1056328732 9:85504063-85504085 GTGTGACTGAATTTGGAGATAGG - Intergenic
1056388824 9:86121598-86121620 ATGTGACTGTATTTGGAGGTGGG - Intergenic
1056442527 9:86634994-86635016 ATGTGACTGTATTTGGAGAAAGG - Intergenic
1056598984 9:88031249-88031271 ATGTGACTGTATTTGGAGGCAGG - Intergenic
1057178151 9:93014176-93014198 TGGTGTCTGGATGTGGAGGAGGG - Intronic
1057320086 9:94004766-94004788 ATGTGACTGTATTTGGAGTAAGG - Intergenic
1058069753 9:100589950-100589972 TTCTGTTTGAATTTGGGGCATGG + Intergenic
1058652846 9:107193259-107193281 ATGTGACTGTATTTGGAGAAAGG + Intergenic
1058666793 9:107326188-107326210 TTTTGTCTGAATTTGGTGTCTGG + Intronic
1059124416 9:111670251-111670273 TTGTGTCTGATTTTGTATTAAGG + Intergenic
1059223399 9:112647678-112647700 TTGTGTCTGGTTTTCTAGGAGGG - Intronic
1059414472 9:114154742-114154764 GTGTGTCTGAGTTTGGGGAAAGG + Intergenic
1059435894 9:114276022-114276044 GTGTGTCTGGATATGGGGGATGG - Intronic
1059709200 9:116851963-116851985 TTAACTCTGAATTTGTAGGAAGG + Intronic
1060649757 9:125315253-125315275 TTGTGTGTGTGTGTGGAGGATGG - Intronic
1185655055 X:1677822-1677844 ATGTGGCTGTATTTGGAGGTAGG + Intergenic
1185759877 X:2682354-2682376 ATGTGTCTGTATTTGCAGCAAGG - Intergenic
1186188630 X:7046184-7046206 ATGTGTCTGTATTTGGAGCTAGG + Intergenic
1186304798 X:8244706-8244728 TTGTCTCTGGAATTGGAGAATGG - Intergenic
1186427428 X:9473996-9474018 TAGTCTCTAAATTTGGGGGAAGG + Intronic
1186513217 X:10146784-10146806 TTGGATGTGAATTTGGAGGGGGG - Intergenic
1186683740 X:11902579-11902601 ATGTGATAGAATTTGGAGGAGGG - Intergenic
1187555476 X:20347058-20347080 TTGTCTCTGCATCTTGAGGATGG + Intergenic
1188050471 X:25479085-25479107 ATGTGACTACATTTGGAGGAAGG - Intergenic
1188429612 X:30091500-30091522 TTGTTTCTTAATTGGGAGAAGGG + Intergenic
1188781537 X:34292534-34292556 TTGTCTCTGCATTTGCAGAAGGG - Intergenic
1189069630 X:37849609-37849631 CTGGCTTTGAATTTGGAGGAAGG - Intronic
1189072243 X:37876181-37876203 TTATTTCTGAAATAGGAGGAGGG + Intronic
1189220630 X:39368827-39368849 TTGTGTCTTAGTTTAGAGGTGGG + Intergenic
1190577208 X:51852145-51852167 TTATGTCTGAAGATGGAGAAAGG - Intronic
1190624594 X:52324737-52324759 TTGTGTCTGAATATGGTGCCTGG - Intergenic
1191055635 X:56237179-56237201 TTGTGACTGTATTTGGAGATAGG + Intronic
1191661775 X:63659018-63659040 TGGTGTCAGAATTTGGAGAAGGG - Intronic
1191716162 X:64195153-64195175 TTGTGTGTGTATTTGGAGGTGGG - Intronic
1192594175 X:72388699-72388721 ATGTGGCTGCATTTGGAGCAAGG + Intronic
1192792992 X:74401887-74401909 GTGTGACTATATTTGGAGGAAGG + Intergenic
1192939401 X:75897181-75897203 TTATGTCCTAATTTGGTGGAGGG + Intergenic
1193238183 X:79134159-79134181 ATGTGACTGTATTTGGAGGTGGG - Intergenic
1193454625 X:81715612-81715634 GGGAGGCTGAATTTGGAGGATGG - Intergenic
1193758111 X:85433675-85433697 ATGTGACTGAATTTGGAGATAGG + Intergenic
1194614429 X:96083804-96083826 TTGCCTCTGAATTTTCAGGAAGG + Intergenic
1195128332 X:101830685-101830707 TTATTTCTGAAGTTGGAGGGAGG - Intergenic
1195129003 X:101836796-101836818 TTGTCTCTGAAGTGGAAGGATGG - Intronic
1195177869 X:102328140-102328162 TTATTTCTGAAGTTGGAGGGAGG + Intergenic
1195180995 X:102358953-102358975 TTATTTCTGAAGTTGGAGGGAGG - Intergenic
1195536729 X:106015893-106015915 TTGCTTCTGTATTTGCAGGAGGG - Intergenic
1195556313 X:106228590-106228612 TTGTGTATTGATTTGGAGGCAGG + Intergenic
1195571058 X:106399232-106399254 ATGTGACTGAATTTGGAGATAGG - Intergenic
1197503647 X:127274492-127274514 GTGTGTGTGTGTTTGGAGGAGGG + Intergenic
1197748362 X:129948123-129948145 TTGGATCTGAATGTGGGGGATGG + Intergenic
1199009416 X:142741124-142741146 ATGTGTCTGTATTTGGAGGTAGG - Intergenic
1199537589 X:148920640-148920662 GTGTGTGTGTATTTGGTGGAGGG + Intronic
1200078337 X:153563048-153563070 GTGTGGCTGGATTTGGAGTAAGG - Intronic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1202133590 Y:21637028-21637050 CTGTGTCTCTATTTGGGGGAGGG + Intergenic