ID: 972047314

View in Genome Browser
Species Human (GRCh38)
Location 4:34682820-34682842
Sequence CTGTAAACTCAGTTTGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972047314_972047316 6 Left 972047314 4:34682820-34682842 CCATGTGCAAACTGAGTTTACAG No data
Right 972047316 4:34682849-34682871 CACTAAATTCTAGAATAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972047314 Original CRISPR CTGTAAACTCAGTTTGCACA TGG (reversed) Intergenic
No off target data available for this crispr