ID: 972047927

View in Genome Browser
Species Human (GRCh38)
Location 4:34692705-34692727
Sequence AGTTATCTGCAGGTGATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972047925_972047927 8 Left 972047925 4:34692674-34692696 CCTAACAAAAGCTGTCTCTCAAA No data
Right 972047927 4:34692705-34692727 AGTTATCTGCAGGTGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972047927 Original CRISPR AGTTATCTGCAGGTGATACC AGG Intergenic
No off target data available for this crispr