ID: 972059907

View in Genome Browser
Species Human (GRCh38)
Location 4:34856539-34856561
Sequence CTAAGGGATCTGAACTACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972059907_972059911 -1 Left 972059907 4:34856539-34856561 CCAAGGTAGTTCAGATCCCTTAG No data
Right 972059911 4:34856561-34856583 GAGAAAAAAGTCAAGGAGAAAGG No data
972059907_972059913 8 Left 972059907 4:34856539-34856561 CCAAGGTAGTTCAGATCCCTTAG No data
Right 972059913 4:34856570-34856592 GTCAAGGAGAAAGGAAGGCTTGG No data
972059907_972059908 -8 Left 972059907 4:34856539-34856561 CCAAGGTAGTTCAGATCCCTTAG No data
Right 972059908 4:34856554-34856576 TCCCTTAGAGAAAAAAGTCAAGG No data
972059907_972059912 3 Left 972059907 4:34856539-34856561 CCAAGGTAGTTCAGATCCCTTAG No data
Right 972059912 4:34856565-34856587 AAAAAGTCAAGGAGAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972059907 Original CRISPR CTAAGGGATCTGAACTACCT TGG (reversed) Intergenic
No off target data available for this crispr