ID: 972063774

View in Genome Browser
Species Human (GRCh38)
Location 4:34912825-34912847
Sequence AGTCTTATGACTGTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972063774_972063775 -3 Left 972063774 4:34912825-34912847 CCACATCACACAGTCATAAGACT No data
Right 972063775 4:34912845-34912867 ACTGTCTAAAGTCAACGTGAAGG No data
972063774_972063776 20 Left 972063774 4:34912825-34912847 CCACATCACACAGTCATAAGACT No data
Right 972063776 4:34912868-34912890 AAACATCCTGAAATTAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972063774 Original CRISPR AGTCTTATGACTGTGTGATG TGG (reversed) Intergenic
No off target data available for this crispr