ID: 972067009

View in Genome Browser
Species Human (GRCh38)
Location 4:34960218-34960240
Sequence GTCTCAATAGTCTCTCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972067009_972067014 26 Left 972067009 4:34960218-34960240 CCAACCTGAGAGACTATTGAGAC No data
Right 972067014 4:34960267-34960289 AGTGAACATATTTTCTCTACGGG No data
972067009_972067011 -3 Left 972067009 4:34960218-34960240 CCAACCTGAGAGACTATTGAGAC No data
Right 972067011 4:34960238-34960260 GACATGTAAAATGCAACTTGTGG No data
972067009_972067013 25 Left 972067009 4:34960218-34960240 CCAACCTGAGAGACTATTGAGAC No data
Right 972067013 4:34960266-34960288 GAGTGAACATATTTTCTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972067009 Original CRISPR GTCTCAATAGTCTCTCAGGT TGG (reversed) Intergenic
No off target data available for this crispr