ID: 972067010

View in Genome Browser
Species Human (GRCh38)
Location 4:34960222-34960244
Sequence ACATGTCTCAATAGTCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972067010_972067014 22 Left 972067010 4:34960222-34960244 CCTGAGAGACTATTGAGACATGT No data
Right 972067014 4:34960267-34960289 AGTGAACATATTTTCTCTACGGG No data
972067010_972067011 -7 Left 972067010 4:34960222-34960244 CCTGAGAGACTATTGAGACATGT No data
Right 972067011 4:34960238-34960260 GACATGTAAAATGCAACTTGTGG No data
972067010_972067013 21 Left 972067010 4:34960222-34960244 CCTGAGAGACTATTGAGACATGT No data
Right 972067013 4:34960266-34960288 GAGTGAACATATTTTCTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972067010 Original CRISPR ACATGTCTCAATAGTCTCTC AGG (reversed) Intergenic