ID: 972067013

View in Genome Browser
Species Human (GRCh38)
Location 4:34960266-34960288
Sequence GAGTGAACATATTTTCTCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972067010_972067013 21 Left 972067010 4:34960222-34960244 CCTGAGAGACTATTGAGACATGT No data
Right 972067013 4:34960266-34960288 GAGTGAACATATTTTCTCTACGG No data
972067009_972067013 25 Left 972067009 4:34960218-34960240 CCAACCTGAGAGACTATTGAGAC No data
Right 972067013 4:34960266-34960288 GAGTGAACATATTTTCTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972067013 Original CRISPR GAGTGAACATATTTTCTCTA CGG Intergenic
No off target data available for this crispr