ID: 972067014

View in Genome Browser
Species Human (GRCh38)
Location 4:34960267-34960289
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972067010_972067014 22 Left 972067010 4:34960222-34960244 CCTGAGAGACTATTGAGACATGT No data
Right 972067014 4:34960267-34960289 AGTGAACATATTTTCTCTACGGG No data
972067009_972067014 26 Left 972067009 4:34960218-34960240 CCAACCTGAGAGACTATTGAGAC No data
Right 972067014 4:34960267-34960289 AGTGAACATATTTTCTCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr