ID: 972067999

View in Genome Browser
Species Human (GRCh38)
Location 4:34976184-34976206
Sequence ATGGAAATGGAGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972067990_972067999 25 Left 972067990 4:34976136-34976158 CCCAAACAGATTGAAGACACTGT No data
Right 972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG No data
972067992_972067999 -2 Left 972067992 4:34976163-34976185 CCACGCTTGCCTTTCCTGTGAAT No data
Right 972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG No data
972067991_972067999 24 Left 972067991 4:34976137-34976159 CCAAACAGATTGAAGACACTGTA No data
Right 972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972067999 Original CRISPR ATGGAAATGGAGACTGAGGA GGG Intergenic
No off target data available for this crispr