ID: 972072425

View in Genome Browser
Species Human (GRCh38)
Location 4:35038414-35038436
Sequence GGGCAGAGTGGATCACTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972072425_972072436 7 Left 972072425 4:35038414-35038436 CCGGGGAGTGATCCACTCTGCCC No data
Right 972072436 4:35038444-35038466 CCGCTGAGTGCCAGGGAAACGGG No data
972072425_972072438 17 Left 972072425 4:35038414-35038436 CCGGGGAGTGATCCACTCTGCCC No data
Right 972072438 4:35038454-35038476 CCAGGGAAACGGGCTGCTCATGG No data
972072425_972072434 6 Left 972072425 4:35038414-35038436 CCGGGGAGTGATCCACTCTGCCC No data
Right 972072434 4:35038443-35038465 ACCGCTGAGTGCCAGGGAAACGG No data
972072425_972072432 -1 Left 972072425 4:35038414-35038436 CCGGGGAGTGATCCACTCTGCCC No data
Right 972072432 4:35038436-35038458 CCGGGTCACCGCTGAGTGCCAGG No data
972072425_972072433 0 Left 972072425 4:35038414-35038436 CCGGGGAGTGATCCACTCTGCCC No data
Right 972072433 4:35038437-35038459 CGGGTCACCGCTGAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972072425 Original CRISPR GGGCAGAGTGGATCACTCCC CGG (reversed) Intergenic
No off target data available for this crispr