ID: 972076564

View in Genome Browser
Species Human (GRCh38)
Location 4:35096837-35096859
Sequence CAGTAAGATGTCATCTCTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972076564_972076567 15 Left 972076564 4:35096837-35096859 CCGCAAGAGATGACATCTTACTG No data
Right 972076567 4:35096875-35096897 GGAATGGCTGACCGCTCACTTGG No data
972076564_972076566 -1 Left 972076564 4:35096837-35096859 CCGCAAGAGATGACATCTTACTG No data
Right 972076566 4:35096859-35096881 GCAATAGCAATTTACTGGAATGG No data
972076564_972076565 -6 Left 972076564 4:35096837-35096859 CCGCAAGAGATGACATCTTACTG No data
Right 972076565 4:35096854-35096876 TTACTGCAATAGCAATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972076564 Original CRISPR CAGTAAGATGTCATCTCTTG CGG (reversed) Intergenic
No off target data available for this crispr