ID: 972079753

View in Genome Browser
Species Human (GRCh38)
Location 4:35136365-35136387
Sequence CCAACCTGTGAGAACAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972079753_972079755 3 Left 972079753 4:35136365-35136387 CCAGGGCTGTTCTCACAGGTTGG No data
Right 972079755 4:35136391-35136413 TGAATGCCTGCAGCTCTTTCAGG No data
972079753_972079758 10 Left 972079753 4:35136365-35136387 CCAGGGCTGTTCTCACAGGTTGG No data
Right 972079758 4:35136398-35136420 CTGCAGCTCTTTCAGGCACAGGG No data
972079753_972079762 27 Left 972079753 4:35136365-35136387 CCAGGGCTGTTCTCACAGGTTGG No data
Right 972079762 4:35136415-35136437 ACAGGGTGGAAGCTGCTGGTGGG No data
972079753_972079759 13 Left 972079753 4:35136365-35136387 CCAGGGCTGTTCTCACAGGTTGG No data
Right 972079759 4:35136401-35136423 CAGCTCTTTCAGGCACAGGGTGG No data
972079753_972079757 9 Left 972079753 4:35136365-35136387 CCAGGGCTGTTCTCACAGGTTGG No data
Right 972079757 4:35136397-35136419 CCTGCAGCTCTTTCAGGCACAGG No data
972079753_972079760 23 Left 972079753 4:35136365-35136387 CCAGGGCTGTTCTCACAGGTTGG No data
Right 972079760 4:35136411-35136433 AGGCACAGGGTGGAAGCTGCTGG No data
972079753_972079761 26 Left 972079753 4:35136365-35136387 CCAGGGCTGTTCTCACAGGTTGG No data
Right 972079761 4:35136414-35136436 CACAGGGTGGAAGCTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972079753 Original CRISPR CCAACCTGTGAGAACAGCCC TGG (reversed) Intergenic
No off target data available for this crispr