ID: 972079945

View in Genome Browser
Species Human (GRCh38)
Location 4:35138191-35138213
Sequence TTTCACATGTGGCAATTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972079945_972079951 -3 Left 972079945 4:35138191-35138213 CCCATTAATTGCCACATGTGAAA No data
Right 972079951 4:35138211-35138233 AAACTCCTAAGTGTGTGGGAGGG No data
972079945_972079956 10 Left 972079945 4:35138191-35138213 CCCATTAATTGCCACATGTGAAA No data
Right 972079956 4:35138224-35138246 TGTGGGAGGGAGGTGGCTGGTGG No data
972079945_972079950 -4 Left 972079945 4:35138191-35138213 CCCATTAATTGCCACATGTGAAA No data
Right 972079950 4:35138210-35138232 GAAACTCCTAAGTGTGTGGGAGG No data
972079945_972079952 0 Left 972079945 4:35138191-35138213 CCCATTAATTGCCACATGTGAAA No data
Right 972079952 4:35138214-35138236 CTCCTAAGTGTGTGGGAGGGAGG No data
972079945_972079949 -7 Left 972079945 4:35138191-35138213 CCCATTAATTGCCACATGTGAAA No data
Right 972079949 4:35138207-35138229 TGTGAAACTCCTAAGTGTGTGGG No data
972079945_972079955 7 Left 972079945 4:35138191-35138213 CCCATTAATTGCCACATGTGAAA No data
Right 972079955 4:35138221-35138243 GTGTGTGGGAGGGAGGTGGCTGG No data
972079945_972079948 -8 Left 972079945 4:35138191-35138213 CCCATTAATTGCCACATGTGAAA No data
Right 972079948 4:35138206-35138228 ATGTGAAACTCCTAAGTGTGTGG No data
972079945_972079954 3 Left 972079945 4:35138191-35138213 CCCATTAATTGCCACATGTGAAA No data
Right 972079954 4:35138217-35138239 CTAAGTGTGTGGGAGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972079945 Original CRISPR TTTCACATGTGGCAATTAAT GGG (reversed) Intergenic
No off target data available for this crispr