ID: 972083432

View in Genome Browser
Species Human (GRCh38)
Location 4:35182708-35182730
Sequence CAGCAGCAGCAGTAGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972083432_972083437 27 Left 972083432 4:35182708-35182730 CCACACTGCTACTGCTGCTGCTG No data
Right 972083437 4:35182758-35182780 TGCTGCTACTGCCCTAAAAAGGG No data
972083432_972083436 26 Left 972083432 4:35182708-35182730 CCACACTGCTACTGCTGCTGCTG No data
Right 972083436 4:35182757-35182779 CTGCTGCTACTGCCCTAAAAAGG No data
972083432_972083434 0 Left 972083432 4:35182708-35182730 CCACACTGCTACTGCTGCTGCTG No data
Right 972083434 4:35182731-35182753 CTGGCATATGCAAATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972083432 Original CRISPR CAGCAGCAGCAGTAGCAGTG TGG (reversed) Intergenic
No off target data available for this crispr