ID: 972083432 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:35182708-35182730 |
| Sequence | CAGCAGCAGCAGTAGCAGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972083432_972083437 | 27 | Left | 972083432 | 4:35182708-35182730 | CCACACTGCTACTGCTGCTGCTG | No data | ||
| Right | 972083437 | 4:35182758-35182780 | TGCTGCTACTGCCCTAAAAAGGG | No data | ||||
| 972083432_972083436 | 26 | Left | 972083432 | 4:35182708-35182730 | CCACACTGCTACTGCTGCTGCTG | No data | ||
| Right | 972083436 | 4:35182757-35182779 | CTGCTGCTACTGCCCTAAAAAGG | No data | ||||
| 972083432_972083434 | 0 | Left | 972083432 | 4:35182708-35182730 | CCACACTGCTACTGCTGCTGCTG | No data | ||
| Right | 972083434 | 4:35182731-35182753 | CTGGCATATGCAAATGAGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972083432 | Original CRISPR | CAGCAGCAGCAGTAGCAGTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||