ID: 972084731

View in Genome Browser
Species Human (GRCh38)
Location 4:35201419-35201441
Sequence CAGGCAGAAGACTCTGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972084731_972084738 17 Left 972084731 4:35201419-35201441 CCTCTGACAGAGTCTTCTGCCTG No data
Right 972084738 4:35201459-35201481 ATAATTCAAAATGCAGGTGGAGG No data
972084731_972084736 11 Left 972084731 4:35201419-35201441 CCTCTGACAGAGTCTTCTGCCTG No data
Right 972084736 4:35201453-35201475 GGTTTCATAATTCAAAATGCAGG No data
972084731_972084732 -10 Left 972084731 4:35201419-35201441 CCTCTGACAGAGTCTTCTGCCTG No data
Right 972084732 4:35201432-35201454 CTTCTGCCTGTGTCCCTTCATGG No data
972084731_972084737 14 Left 972084731 4:35201419-35201441 CCTCTGACAGAGTCTTCTGCCTG No data
Right 972084737 4:35201456-35201478 TTCATAATTCAAAATGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972084731 Original CRISPR CAGGCAGAAGACTCTGTCAG AGG (reversed) Intergenic
No off target data available for this crispr