ID: 972087069

View in Genome Browser
Species Human (GRCh38)
Location 4:35231283-35231305
Sequence CTTACCTTACACTCTAATCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972087069_972087072 0 Left 972087069 4:35231283-35231305 CCGCGATTAGAGTGTAAGGTAAG No data
Right 972087072 4:35231306-35231328 AGGGCTAACACAAGAATCTAAGG No data
972087069_972087074 27 Left 972087069 4:35231283-35231305 CCGCGATTAGAGTGTAAGGTAAG No data
Right 972087074 4:35231333-35231355 TTGTGGCAACTAATGTGAATAGG No data
972087069_972087073 10 Left 972087069 4:35231283-35231305 CCGCGATTAGAGTGTAAGGTAAG No data
Right 972087073 4:35231316-35231338 CAAGAATCTAAGGCTTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972087069 Original CRISPR CTTACCTTACACTCTAATCG CGG (reversed) Intergenic
No off target data available for this crispr