ID: 972087073

View in Genome Browser
Species Human (GRCh38)
Location 4:35231316-35231338
Sequence CAAGAATCTAAGGCTTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972087069_972087073 10 Left 972087069 4:35231283-35231305 CCGCGATTAGAGTGTAAGGTAAG No data
Right 972087073 4:35231316-35231338 CAAGAATCTAAGGCTTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972087073 Original CRISPR CAAGAATCTAAGGCTTCTTG TGG Intergenic
No off target data available for this crispr