ID: 972087074

View in Genome Browser
Species Human (GRCh38)
Location 4:35231333-35231355
Sequence TTGTGGCAACTAATGTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972087069_972087074 27 Left 972087069 4:35231283-35231305 CCGCGATTAGAGTGTAAGGTAAG No data
Right 972087074 4:35231333-35231355 TTGTGGCAACTAATGTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972087074 Original CRISPR TTGTGGCAACTAATGTGAAT AGG Intergenic
No off target data available for this crispr