ID: 972090447

View in Genome Browser
Species Human (GRCh38)
Location 4:35275102-35275124
Sequence CAGTATAAAAGCAAAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972090446_972090447 4 Left 972090446 4:35275075-35275097 CCAAAAGTAAGAGACAACAAAAA No data
Right 972090447 4:35275102-35275124 CAGTATAAAAGCAAAGAGACAGG No data
972090445_972090447 16 Left 972090445 4:35275063-35275085 CCATTGCATAAACCAAAAGTAAG No data
Right 972090447 4:35275102-35275124 CAGTATAAAAGCAAAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972090447 Original CRISPR CAGTATAAAAGCAAAGAGAC AGG Intergenic
No off target data available for this crispr