ID: 972091172

View in Genome Browser
Species Human (GRCh38)
Location 4:35286034-35286056
Sequence CTTAAGGAGGACAGAATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972091172_972091178 6 Left 972091172 4:35286034-35286056 CCCTTGATTCTGTCCTCCTTAAG No data
Right 972091178 4:35286063-35286085 CGAAGGTTCAGCTGACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972091172 Original CRISPR CTTAAGGAGGACAGAATCAA GGG (reversed) Intergenic
No off target data available for this crispr