ID: 972095162

View in Genome Browser
Species Human (GRCh38)
Location 4:35339967-35339989
Sequence TAGGACCCTGAAACTTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972095157_972095162 16 Left 972095157 4:35339928-35339950 CCATGTGTCTACTGTTAAGCGAG No data
Right 972095162 4:35339967-35339989 TAGGACCCTGAAACTTGGCAAGG No data
972095156_972095162 21 Left 972095156 4:35339923-35339945 CCTCACCATGTGTCTACTGTTAA No data
Right 972095162 4:35339967-35339989 TAGGACCCTGAAACTTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972095162 Original CRISPR TAGGACCCTGAAACTTGGCA AGG Intergenic
No off target data available for this crispr