ID: 972095489

View in Genome Browser
Species Human (GRCh38)
Location 4:35342660-35342682
Sequence GTTACTTGCAGAAGACGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972095489_972095496 21 Left 972095489 4:35342660-35342682 CCCTGCCGTCTTCTGCAAGTAAC No data
Right 972095496 4:35342704-35342726 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
972095489_972095494 14 Left 972095489 4:35342660-35342682 CCCTGCCGTCTTCTGCAAGTAAC No data
Right 972095494 4:35342697-35342719 GAATGCTCTTGGCCTGTTACTGG No data
972095489_972095497 25 Left 972095489 4:35342660-35342682 CCCTGCCGTCTTCTGCAAGTAAC No data
Right 972095497 4:35342708-35342730 GCCTGTTACTGGGCTTTGGTAGG No data
972095489_972095495 15 Left 972095489 4:35342660-35342682 CCCTGCCGTCTTCTGCAAGTAAC No data
Right 972095495 4:35342698-35342720 AATGCTCTTGGCCTGTTACTGGG No data
972095489_972095492 3 Left 972095489 4:35342660-35342682 CCCTGCCGTCTTCTGCAAGTAAC No data
Right 972095492 4:35342686-35342708 TCCTTTTGAGAGAATGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972095489 Original CRISPR GTTACTTGCAGAAGACGGCA GGG (reversed) Intergenic
No off target data available for this crispr