ID: 972095490

View in Genome Browser
Species Human (GRCh38)
Location 4:35342661-35342683
Sequence AGTTACTTGCAGAAGACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972095490_972095495 14 Left 972095490 4:35342661-35342683 CCTGCCGTCTTCTGCAAGTAACT No data
Right 972095495 4:35342698-35342720 AATGCTCTTGGCCTGTTACTGGG No data
972095490_972095496 20 Left 972095490 4:35342661-35342683 CCTGCCGTCTTCTGCAAGTAACT No data
Right 972095496 4:35342704-35342726 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
972095490_972095494 13 Left 972095490 4:35342661-35342683 CCTGCCGTCTTCTGCAAGTAACT No data
Right 972095494 4:35342697-35342719 GAATGCTCTTGGCCTGTTACTGG No data
972095490_972095497 24 Left 972095490 4:35342661-35342683 CCTGCCGTCTTCTGCAAGTAACT No data
Right 972095497 4:35342708-35342730 GCCTGTTACTGGGCTTTGGTAGG No data
972095490_972095492 2 Left 972095490 4:35342661-35342683 CCTGCCGTCTTCTGCAAGTAACT No data
Right 972095492 4:35342686-35342708 TCCTTTTGAGAGAATGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972095490 Original CRISPR AGTTACTTGCAGAAGACGGC AGG (reversed) Intergenic
No off target data available for this crispr