ID: 972095492

View in Genome Browser
Species Human (GRCh38)
Location 4:35342686-35342708
Sequence TCCTTTTGAGAGAATGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972095491_972095492 -2 Left 972095491 4:35342665-35342687 CCGTCTTCTGCAAGTAACTCTTC No data
Right 972095492 4:35342686-35342708 TCCTTTTGAGAGAATGCTCTTGG No data
972095489_972095492 3 Left 972095489 4:35342660-35342682 CCCTGCCGTCTTCTGCAAGTAAC No data
Right 972095492 4:35342686-35342708 TCCTTTTGAGAGAATGCTCTTGG No data
972095490_972095492 2 Left 972095490 4:35342661-35342683 CCTGCCGTCTTCTGCAAGTAACT No data
Right 972095492 4:35342686-35342708 TCCTTTTGAGAGAATGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972095492 Original CRISPR TCCTTTTGAGAGAATGCTCT TGG Intergenic
No off target data available for this crispr