ID: 972095494

View in Genome Browser
Species Human (GRCh38)
Location 4:35342697-35342719
Sequence GAATGCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972095490_972095494 13 Left 972095490 4:35342661-35342683 CCTGCCGTCTTCTGCAAGTAACT No data
Right 972095494 4:35342697-35342719 GAATGCTCTTGGCCTGTTACTGG No data
972095491_972095494 9 Left 972095491 4:35342665-35342687 CCGTCTTCTGCAAGTAACTCTTC No data
Right 972095494 4:35342697-35342719 GAATGCTCTTGGCCTGTTACTGG No data
972095489_972095494 14 Left 972095489 4:35342660-35342682 CCCTGCCGTCTTCTGCAAGTAAC No data
Right 972095494 4:35342697-35342719 GAATGCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972095494 Original CRISPR GAATGCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr