ID: 972095495

View in Genome Browser
Species Human (GRCh38)
Location 4:35342698-35342720
Sequence AATGCTCTTGGCCTGTTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972095491_972095495 10 Left 972095491 4:35342665-35342687 CCGTCTTCTGCAAGTAACTCTTC No data
Right 972095495 4:35342698-35342720 AATGCTCTTGGCCTGTTACTGGG No data
972095489_972095495 15 Left 972095489 4:35342660-35342682 CCCTGCCGTCTTCTGCAAGTAAC No data
Right 972095495 4:35342698-35342720 AATGCTCTTGGCCTGTTACTGGG No data
972095490_972095495 14 Left 972095490 4:35342661-35342683 CCTGCCGTCTTCTGCAAGTAACT No data
Right 972095495 4:35342698-35342720 AATGCTCTTGGCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972095495 Original CRISPR AATGCTCTTGGCCTGTTACT GGG Intergenic
No off target data available for this crispr