ID: 972097194

View in Genome Browser
Species Human (GRCh38)
Location 4:35363357-35363379
Sequence TTGGTGTTCTTGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972097194_972097198 -7 Left 972097194 4:35363357-35363379 CCCTTTTTCCTCAAGAACACCAA No data
Right 972097198 4:35363373-35363395 ACACCAATTATTTTTAGGTTTGG No data
972097194_972097199 -6 Left 972097194 4:35363357-35363379 CCCTTTTTCCTCAAGAACACCAA No data
Right 972097199 4:35363374-35363396 CACCAATTATTTTTAGGTTTGGG No data
972097194_972097201 24 Left 972097194 4:35363357-35363379 CCCTTTTTCCTCAAGAACACCAA No data
Right 972097201 4:35363404-35363426 AATAATTCCAAACTTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972097194 Original CRISPR TTGGTGTTCTTGAGGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr