ID: 972099346

View in Genome Browser
Species Human (GRCh38)
Location 4:35392959-35392981
Sequence GCACACACCCTAACATTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972099346_972099348 11 Left 972099346 4:35392959-35392981 CCTAGAAATGTTAGGGTGTGTGC No data
Right 972099348 4:35392993-35393015 CATTAAACTTAATAACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972099346 Original CRISPR GCACACACCCTAACATTTCT AGG (reversed) Intergenic
No off target data available for this crispr