ID: 972101644

View in Genome Browser
Species Human (GRCh38)
Location 4:35427441-35427463
Sequence TTTATACTAAAACCATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972101644_972101649 19 Left 972101644 4:35427441-35427463 CCTCCCAATGGTTTTAGTATAAA No data
Right 972101649 4:35427483-35427505 TTGCAATGTGTTATACCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972101644 Original CRISPR TTTATACTAAAACCATTGGG AGG (reversed) Intergenic
No off target data available for this crispr