ID: 972107436

View in Genome Browser
Species Human (GRCh38)
Location 4:35507361-35507383
Sequence GACAAATCTTCAACTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972107436_972107437 15 Left 972107436 4:35507361-35507383 CCAGTAACAGTTGAAGATTTGTC No data
Right 972107437 4:35507399-35507421 CAAATTCAACTTTTTCGCTGTGG No data
972107436_972107438 16 Left 972107436 4:35507361-35507383 CCAGTAACAGTTGAAGATTTGTC No data
Right 972107438 4:35507400-35507422 AAATTCAACTTTTTCGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972107436 Original CRISPR GACAAATCTTCAACTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr