ID: 972109466

View in Genome Browser
Species Human (GRCh38)
Location 4:35539586-35539608
Sequence ACTATTTTTAGCTTTGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972109466_972109469 23 Left 972109466 4:35539586-35539608 CCTTTTACAAAGCTAAAAATAGT No data
Right 972109469 4:35539632-35539654 GGCTTATATATGTTTACCCAAGG No data
972109466_972109470 24 Left 972109466 4:35539586-35539608 CCTTTTACAAAGCTAAAAATAGT No data
Right 972109470 4:35539633-35539655 GCTTATATATGTTTACCCAAGGG No data
972109466_972109467 2 Left 972109466 4:35539586-35539608 CCTTTTACAAAGCTAAAAATAGT No data
Right 972109467 4:35539611-35539633 AACCATAAGATGTAGCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972109466 Original CRISPR ACTATTTTTAGCTTTGTAAA AGG (reversed) Intergenic
No off target data available for this crispr