ID: 972109468

View in Genome Browser
Species Human (GRCh38)
Location 4:35539613-35539635
Sequence AGCCTGATTGCTACATCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972109468_972109470 -3 Left 972109468 4:35539613-35539635 CCATAAGATGTAGCAATCAGGCT No data
Right 972109470 4:35539633-35539655 GCTTATATATGTTTACCCAAGGG No data
972109468_972109469 -4 Left 972109468 4:35539613-35539635 CCATAAGATGTAGCAATCAGGCT No data
Right 972109469 4:35539632-35539654 GGCTTATATATGTTTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972109468 Original CRISPR AGCCTGATTGCTACATCTTA TGG (reversed) Intergenic
No off target data available for this crispr