ID: 972109470

View in Genome Browser
Species Human (GRCh38)
Location 4:35539633-35539655
Sequence GCTTATATATGTTTACCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972109468_972109470 -3 Left 972109468 4:35539613-35539635 CCATAAGATGTAGCAATCAGGCT No data
Right 972109470 4:35539633-35539655 GCTTATATATGTTTACCCAAGGG No data
972109466_972109470 24 Left 972109466 4:35539586-35539608 CCTTTTACAAAGCTAAAAATAGT No data
Right 972109470 4:35539633-35539655 GCTTATATATGTTTACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972109470 Original CRISPR GCTTATATATGTTTACCCAA GGG Intergenic
No off target data available for this crispr