ID: 972109586

View in Genome Browser
Species Human (GRCh38)
Location 4:35541277-35541299
Sequence GATTTCAGCAGACACGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972109584_972109586 -2 Left 972109584 4:35541256-35541278 CCAGAGACTGGACAGAAACGGGA No data
Right 972109586 4:35541277-35541299 GATTTCAGCAGACACGGAGCTGG No data
972109581_972109586 3 Left 972109581 4:35541251-35541273 CCTGTCCAGAGACTGGACAGAAA No data
Right 972109586 4:35541277-35541299 GATTTCAGCAGACACGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972109586 Original CRISPR GATTTCAGCAGACACGGAGC TGG Intergenic
No off target data available for this crispr