ID: 972112570

View in Genome Browser
Species Human (GRCh38)
Location 4:35583324-35583346
Sequence CTGAAAAAACTGATGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972112570_972112571 -4 Left 972112570 4:35583324-35583346 CCTTTGTTCATCAGTTTTTTCAG No data
Right 972112571 4:35583343-35583365 TCAGTGATGAGCAGTGAATCTGG No data
972112570_972112573 -2 Left 972112570 4:35583324-35583346 CCTTTGTTCATCAGTTTTTTCAG No data
Right 972112573 4:35583345-35583367 AGTGATGAGCAGTGAATCTGGGG No data
972112570_972112575 17 Left 972112570 4:35583324-35583346 CCTTTGTTCATCAGTTTTTTCAG No data
Right 972112575 4:35583364-35583386 GGGGCACTTCTATCTGTGTTGGG No data
972112570_972112572 -3 Left 972112570 4:35583324-35583346 CCTTTGTTCATCAGTTTTTTCAG No data
Right 972112572 4:35583344-35583366 CAGTGATGAGCAGTGAATCTGGG No data
972112570_972112574 16 Left 972112570 4:35583324-35583346 CCTTTGTTCATCAGTTTTTTCAG No data
Right 972112574 4:35583363-35583385 TGGGGCACTTCTATCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972112570 Original CRISPR CTGAAAAAACTGATGAACAA AGG (reversed) Intergenic
No off target data available for this crispr