ID: 972115468

View in Genome Browser
Species Human (GRCh38)
Location 4:35627787-35627809
Sequence GGATATGCAATATGGACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972115465_972115468 2 Left 972115465 4:35627762-35627784 CCATGAATGAAAGAGAAGCAGAG No data
Right 972115468 4:35627787-35627809 GGATATGCAATATGGACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972115468 Original CRISPR GGATATGCAATATGGACAAT AGG Intergenic
No off target data available for this crispr