ID: 972125399

View in Genome Browser
Species Human (GRCh38)
Location 4:35758931-35758953
Sequence AGGGAGATTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972125399_972125406 14 Left 972125399 4:35758931-35758953 CCCACAATCACTGCAATCTCCCT No data
Right 972125406 4:35758968-35758990 GATTTTCTTTCTACTCCATGTGG No data
972125399_972125407 26 Left 972125399 4:35758931-35758953 CCCACAATCACTGCAATCTCCCT No data
Right 972125407 4:35758980-35759002 ACTCCATGTGGCTACTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972125399 Original CRISPR AGGGAGATTGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr